View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_27 (Length: 254)
Name: NF0937_low_27
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 3419539 - 3419739
Alignment:
| Q |
1 |
ttgctggcacttgtcgcaccagaaaacacatctcattgtcgttgtcataattggggaccacattatctgcattctta-tattattaatataaatggcatt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3419539 |
ttgctggcacttgtcgcaccagaaaacacatctcattgtcgttgtcataattggggaccacattatctgcattcttattattattaatataaatggcatt |
3419638 |
T |
 |
| Q |
100 |
tacttgattattttggttattctct--nnnnnnnnntgattattttggttacgttacttaattaaataaaaaagaccgcaacaccctatacttttctaac |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3419639 |
tacttgattattttggttattctctcaaaaaaaaattgattattttggttacgttacttaattaaataaaaaagaccgcaacaccctatacttttctaac |
3419738 |
T |
 |
| Q |
198 |
a |
198 |
Q |
| |
|
| |
|
|
| T |
3419739 |
a |
3419739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University