View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_28 (Length: 253)
Name: NF0937_low_28
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 32 - 238
Target Start/End: Original strand, 40955710 - 40955924
Alignment:
| Q |
32 |
gaaccaaatggacctccttttttaaaagtcttttttgcatgcttttgagtgtagataaagattctaacctttgagtgtggacc----tagatgtgtaatg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40955710 |
gaaccaaatggacctccttttttaaaagtcttttttgcatgcttttgagtgtagataaagattctaacctttgagtgtggacctagatagatgtgtaatg |
40955809 |
T |
 |
| Q |
128 |
aaaagaagaaagtaaattaataagtgcgatgcttattgcttaccca----atgtgaatgttttgtggcagaatgttggtggaagttaacaagcatacgga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40955810 |
aaaagaagaaagtaaattaataagtgcgatgcttattgcttacccaatatatgtgaatgttttgtggcagaatgttggtggaagttaacaagcatacgga |
40955909 |
T |
 |
| Q |
224 |
agggtccaaggagaa |
238 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
40955910 |
agggtccaaggagaa |
40955924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University