View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_36 (Length: 214)
Name: NF0937_low_36
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_36 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 81 - 214
Target Start/End: Original strand, 32866670 - 32866803
Alignment:
| Q |
81 |
attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatttgaactgtacctt |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32866670 |
attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatctgaactgtacctt |
32866769 |
T |
 |
| Q |
181 |
nnnnnnngtgaacataaaatatacatattctcta |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32866770 |
aaaaaaagtgaacataaaatatacatattctcta |
32866803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University