View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_39 (Length: 202)
Name: NF0937_low_39
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0937_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 5 - 117
Target Start/End: Original strand, 34379087 - 34379199
Alignment:
Q |
5 |
cttgcttctatatataccacttttctcattcgttcaatcatacaatcttctttctaaacattctcatatatcataagtctaataagtccttacctctttc |
104 |
Q |
|
|
||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
34379087 |
cttgcttctatatataccacttttctcattcatttcatcacacaatcttctttctaaacattctcatatatcataagtcttataagtccttacctctttc |
34379186 |
T |
 |
Q |
105 |
tttcttgagtatt |
117 |
Q |
|
|
||||||||||||| |
|
|
T |
34379187 |
tttcttgagtatt |
34379199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University