View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0937_low_7 (Length: 511)
Name: NF0937_low_7
Description: NF0937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0937_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 7e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 29 - 248
Target Start/End: Original strand, 4809245 - 4809475
Alignment:
| Q |
29 |
agaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatagggagtactactcatgttttatactggattgttag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4809245 |
agaaatgatagggaaaaagaagccattcttagttactgattttcagtcttggtgtacaaaacatagggagtactactcatgttttatactggattgttag |
4809344 |
T |
|
| Q |
129 |
gaggatcaatgagtgggtggggggttgtgcaattattgattagattacgtcagggctgatgtcacatgcct--------------accccacaaacctaa |
214 |
Q |
| |
|
| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
4809345 |
ggggatcaatgagtgaagggggg---gtgcaattattgattagattacgtcagggctgatgtcatatgcctaaggattaacttacaccccacaaacctaa |
4809441 |
T |
|
| Q |
215 |
ccaaactttctaaaagggacatccttcggggtga |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4809442 |
ccaaactttctaaaagggacatccttcggggtga |
4809475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 402 - 498
Target Start/End: Original strand, 4809630 - 4809726
Alignment:
| Q |
402 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaagttcggagtaccatactctcaagctataatgtttatatatt |
498 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
4809630 |
gtagttcttgtttttgtcttaactttaagagtgggtcttatagtgtaggctttgaggttcggagtaccctagtctcaagctttaatgtttatatatt |
4809726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University