View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938-Insertion-18 (Length: 116)
Name: NF0938-Insertion-18
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0938-Insertion-18 |
 |  |
|
| [»] scaffold0649 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0649 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: scaffold0649
Description:
Target: scaffold0649; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 7 - 116
Target Start/End: Original strand, 6296 - 6405
Alignment:
| Q |
7 |
acaacgcaacttcaagcacaagagttgtggctggtacatgatggaataatgggaagaaaggatgaaagcgttattggagcttcaatttcttcatttatag |
106 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6296 |
acaacccaacttcaagcacaagcattgtgtatggtacatgatggaataatgggaagaaaggatgaaagcgttattggagcttcaatttcttcatttatag |
6395 |
T |
 |
| Q |
107 |
cacaaacatt |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
6396 |
cacaaacatt |
6405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University