View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938-Insertion-21 (Length: 54)
Name: NF0938-Insertion-21
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0938-Insertion-21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 6e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-17
Query Start/End: Original strand, 7 - 54
Target Start/End: Original strand, 8381662 - 8381709
Alignment:
| Q |
7 |
agaaaataaccttcagtttttctaactggaaagcagcgttcattaacc |
54 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8381662 |
agaaaataaccttcaatttttctaactggaaagcagcgttcattaacc |
8381709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University