View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938_high_15 (Length: 257)
Name: NF0938_high_15
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0938_high_15 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 27 - 257
Target Start/End: Complemental strand, 55694911 - 55694683
Alignment:
Q |
27 |
acatcatcaaaatcatacttcataattcatatgtcttatcttcaaataacttgatagatatttttgattgaagttctgctttaaataacaataatacaat |
126 |
Q |
|
|
|||| ||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| | ||| || |||||||| |
|
|
T |
55694911 |
acatgatcaaaa-catacttcataattcatatgtcttatattcaaataacttgatagatatttttgattgaagtgctgcttctagtaataaaaatacaat |
55694813 |
T |
 |
Q |
127 |
gtagtagaatcaattaannnnnnnaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatctacactaatttgttg |
226 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
55694812 |
gtagtagaatcaatta-ttttttcaagagcaaattgattattgatcttttttggattatgaaaaataaacacagggaaagagatctacactaatttgttg |
55694714 |
T |
 |
Q |
227 |
tttataatccattggactaatatttttgttt |
257 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
55694713 |
tttataatccattggactaatatttttgttt |
55694683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University