View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938_low_17 (Length: 284)
Name: NF0938_low_17
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0938_low_17 |
 |  |
|
| [»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 41 - 256
Target Start/End: Original strand, 22365452 - 22365667
Alignment:
| Q |
41 |
gagaggatagaatgaaaaccatttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagatacaaattatatggtccgctctttccgtca |
140 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| || |
|
|
| T |
22365452 |
gagaagatagaatgaaaatcatttatgttgtgtggtagtgagtgcacacaaatcaaaccattttgatagacacatattatatggtccgctctttccgcca |
22365551 |
T |
 |
| Q |
141 |
cataccatgaaagtggttctgacaaccgcaaattccacatatacctcgggcagttctcccctccccttgagatttctgctaatcaaatattttatcgctc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
22365552 |
cataccatgaaagtggttctgacaaccgcaaattccacctatacctcgggcagttctcccctccccttgagatttctgctaatcatatattttatcgctc |
22365651 |
T |
 |
| Q |
241 |
atactcatttcaattt |
256 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
22365652 |
atactcatttcaattt |
22365667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 5 - 43
Target Start/End: Complemental strand, 229267 - 229229
Alignment:
| Q |
5 |
catacaagcaaaggtcaactgtttttaatgtagagtgag |
43 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
229267 |
catacaagcaaaggtcaactgtttttaatgtagagtgag |
229229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University