View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938_low_20 (Length: 257)
Name: NF0938_low_20
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0938_low_20 |
 |  |
|
| [»] scaffold0141 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 8 - 172
Target Start/End: Original strand, 2625268 - 2625432
Alignment:
| Q |
8 |
cgaaaaatatccacaaaaccaacctcttgatttccgagattttttatcgtctatcgtttattttccaaataaatataatggatcgggattggtacaaggt |
107 |
Q |
| |
|
|||| |||||||||||||| ||| | ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2625268 |
cgaagaatatccacaaaactgaccccctgatttccgagatgttttattgtctatcgtttattttccaaataaatataatggatcgggattggtacaaggt |
2625367 |
T |
 |
| Q |
108 |
cacctattgctcctaagaacctaacagaactttttaaaagtttttaaacaccatccacggtctta |
172 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||| ||||||||| ||| ||||| |
|
|
| T |
2625368 |
cacctattgctcctaagaacctaacagagctttttataagttttttaacaccatcaacgttctta |
2625432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 36 - 154
Target Start/End: Complemental strand, 27244935 - 27244817
Alignment:
| Q |
36 |
gatttccgagattttttatcgtctatcgtttattttccaaataaatataatggatcgggattggtacaaggtcacctattgctcctaagaacctaacaga |
135 |
Q |
| |
|
|||||||||||| |||||| |||||||||| |||||| || |||| ||||||||||||||||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
27244935 |
gatttccgagatgttttattgtctatcgttgtttttccgaacaaatctaatggatcgggattggtataaggtcacctattgctattaagaatctaacaga |
27244836 |
T |
 |
| Q |
136 |
actttttaaaagtttttaa |
154 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
27244835 |
acttttaaaaagtttttaa |
27244817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 172 - 243
Target Start/End: Complemental strand, 2625505 - 2625434
Alignment:
| Q |
172 |
agatggcctttcttggtataataacttgggctattcggtagcatagaaccttgaagttgcagaagaaaaagt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2625505 |
agatggcctttcttggtataataacttgggctatttggtagcatagaaacttgaagttgcagaagaaaaagt |
2625434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0141 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0141
Description:
Target: scaffold0141; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 2614 - 2573
Alignment:
| Q |
113 |
attgctcctaagaacctaacagaactttttaaaagtttttaa |
154 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2614 |
attgctactaagaacctaacagaactttttaaaagtttttaa |
2573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University