View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938_low_23 (Length: 251)
Name: NF0938_low_23
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0938_low_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 14 - 240
Target Start/End: Original strand, 34650867 - 34651096
Alignment:
| Q |
14 |
tgattttgcaaacgttacaaagtgtagcctttgaaaatcaaggtgactcgtcgtggttctcacaaaaattgtgataccaaacatgtatgtaattgcccaa |
113 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34650867 |
tgattttgcaaaagttacaaagtgtaacctttgaaaatcaaggtgacttgtcgtggttctgacagaaattgtgataccaaacatgtatgtaattgcccaa |
34650966 |
T |
 |
| Q |
114 |
catactttaagatataaagcnnnnnnnnnnnnttggtaatcaataagccagtgataacnnnnnnnggttccatg---caaggtaagataaccaccaatct |
210 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
34650967 |
catacttttagatataaagcaaaaaacaaaaattggtaatcaataagccagtgataactttttttggttccatgcaacaaggtaagataaccaccaatct |
34651066 |
T |
 |
| Q |
211 |
catcgggaattcaggctttatattagaatt |
240 |
Q |
| |
|
||| ||||||| |||||||||||||||||| |
|
|
| T |
34651067 |
cattgggaattgaggctttatattagaatt |
34651096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University