View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0938_low_9 (Length: 347)
Name: NF0938_low_9
Description: NF0938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0938_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 6e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 111 - 334
Target Start/End: Original strand, 43712087 - 43712308
Alignment:
Q |
111 |
accctttgctcaattctatttaatgttgtattatttcttttctttt-ataggaataatacttgatgttacgtatcggagggagaggattattttgcatac |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
T |
43712087 |
accctttgctcaattctatttaatgttgtattatttcttttctttttataagaataatacttgatgttacgtataggagg-agaggattattttgcatac |
43712185 |
T |
 |
Q |
210 |
atacatacatacgtgatttgcatatttatcaaaagtacataatataatcatattcatgaaatacaatgtgtggacccatatacatacttatataagctca |
309 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
T |
43712186 |
atacatacatacgtgatttgcatatttatcaaaagtacataatataatcatattcatgaaatacaatgt-cagacccatatacatatttatataagctca |
43712284 |
T |
 |
Q |
310 |
ccccccgcttcattattatgtgcct |
334 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
43712285 |
-cccccgcttcattattatgtgcct |
43712308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University