View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_high_26 (Length: 331)
Name: NF0939_high_26
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0939_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 234
Target Start/End: Original strand, 48098023 - 48098252
Alignment:
| Q |
5 |
tttgaaagatgctcgtatcacatgtttaagaagctcaatgaatatgggtgcacctcacgtggaagtcgcaattgcatgcttgtctacgggtatgtatcta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48098023 |
tttgaaagatgctcgtatcacatgtttaagaagctcaatgaatatgggtgcacctcacgtggaagtcgcaattgcatgcttgtctacgggtatgtatcta |
48098122 |
T |
|
| Q |
105 |
atggaactgtggctgatcacgttcatggcaacaaagcaatagagggaaaattaacttagaaggttaggatgaatattgtagtggagaccactagagcact |
204 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48098123 |
atggaactgtggctaatcaccttcatggcaacaaagcaatagagggaaaattaacttagaaggttaggatgaatattgtagtggagaccactagagcact |
48098222 |
T |
|
| Q |
205 |
aaaacatcttcatgcttctaacgacattaa |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48098223 |
aaaacatcttcatgcttctaacgacattaa |
48098252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University