View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_high_32 (Length: 293)
Name: NF0939_high_32
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0939_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 67 - 245
Target Start/End: Original strand, 24892690 - 24892868
Alignment:
Q |
67 |
agtctctgactcagtcaacctaacacaaactaacagacaaaatattttcacaacatagtatctcagtcatttttaaattttaatgttggcggtgtcagca |
166 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
24892690 |
agtctctgactcagtcaacctaacacaaactcacagacaaaatattttcacaacatagcatctcagtcatttttaaattttaatgttggcagtgtcagca |
24892789 |
T |
 |
Q |
167 |
gtcacttcatgctctacctcaaacatcctttatttcaaaaattcattcttcgttggaacatcgcaaatcataggttcat |
245 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
24892790 |
gtcacttcatgctctacctcaaacgtcctttatttcaaaaattcattcttcattggaacatcgcaaatcataggttcat |
24892868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University