View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_high_34 (Length: 281)
Name: NF0939_high_34
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0939_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 41 - 222
Target Start/End: Original strand, 3862588 - 3862769
Alignment:
| Q |
41 |
gatgaagattatgtctatgtgatgttgtctaatatgtatgcatcttttggaagatgggaagatgttaatgtaattaggagtctcatgagtaagaaaaggg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3862588 |
gatgaagattatgtctatgtgatgttgtctaatatgtatgcatcttttggaagatgggaagatgttaatgtaattaggagtctcatgagtaagaaaaggg |
3862687 |
T |
 |
| Q |
141 |
ttaggaaagaagcaggttctagctggatagaagtaaatagataactttgtcccatatgaaactaccgtatagaagcatgtgg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3862688 |
ttaggaaagaagcaggttctagctggatagaagtaaatagataactttgtcccatatgaaattaccgtatagaagcatgtgg |
3862769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University