View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_low_21 (Length: 419)
Name: NF0939_low_21
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0939_low_21 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 6 - 314
Target Start/End: Original strand, 45540970 - 45541275
Alignment:
| Q |
6 |
aggagcagagatacaaaacccgccgatacaattgatggagcgtccaagtgaaaatgtgactaatgcccaatatgtctttccatctcatgtatttgctaga |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540970 |
aggaccagagatacaaaacccgccgatacaattgatggagcgtccaagtgaaaatgtgactaatgcccaatatgtctttccatctcatgtatttgctaga |
45541069 |
T |
 |
| Q |
106 |
aacaatacaaatgccccagtagaatggagcactgcctctaacgaatcactcttcagcatttatatgggaaatacaagtttctcaagtgaactagcttgct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541070 |
aacaatacaaatgccccagtagaatggagcactgcctctaacgaatcactcttcagcatttatatgggaaatacaagtttctcaagtgaactagcttgct |
45541169 |
T |
 |
| Q |
206 |
tcaaatcttcttctgatttagataagtctggtgatgtatatatgtccgatcagcatattgcttcgccaaatcatcaacctccagtacctgtgaataaatt |
305 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45541170 |
tcaaa---tcttctgatttagataagtctggtgatgtatgtatgtccgatcagtatattgcttcgccaaatcatcaacctccagtacctgtgaataaatt |
45541266 |
T |
 |
| Q |
306 |
caacgctat |
314 |
Q |
| |
|
||||||||| |
|
|
| T |
45541267 |
caacgctat |
45541275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 391 - 419
Target Start/End: Original strand, 42946274 - 42946302
Alignment:
| Q |
391 |
cttattctcagtaccaaatcctttcccca |
419 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42946274 |
cttattctcagtaccaaatcctttcccca |
42946302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University