View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_low_47 (Length: 290)
Name: NF0939_low_47
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0939_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 7e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 123 - 279
Target Start/End: Complemental strand, 40379965 - 40379809
Alignment:
Q |
123 |
acacataccttaattccgttaaattcattgtcaatcaaaacatgcatcaagtcaaatcacattacagattcaagaatccaagcgacaaaattgttgtcat |
222 |
Q |
|
|
||||| ||| ||| ||||||||||||| || ||||||||||||||| ||||||||| |||||||| || ||||||||||||||||||||||||||| | |
|
|
T |
40379965 |
acacacaccctaactccgttaaattcacagtaaatcaaaacatgcattaagtcaaattacattacatatggaagaatccaagcgacaaaattgttgtcgt |
40379866 |
T |
 |
Q |
223 |
attattaggattaagagcaatgatcctaatactctaaaatacaacttctcatcctat |
279 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40379865 |
attattaggattaagagcaatgatcctaatactctaaaatacaacttctcatcctat |
40379809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University