View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_low_54 (Length: 251)
Name: NF0939_low_54
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0939_low_54 |
 |  |
|
| [»] scaffold0147 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 203
Target Start/End: Original strand, 7590 - 7780
Alignment:
| Q |
13 |
aatatctagataaaccggacttttaaggcgagaatagtagtgaagtgcttcttcgatgtctagtacgtgttcaagatcacctgaatccatcatatctaat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7590 |
aatatctagataaaccggacttttaaggcgagaatagtagtgaagtgcttcttcgatgtctagtacgtgttcaagatcacctgaatccatcatatctaat |
7689 |
T |
 |
| Q |
113 |
tccttcatcttctgtgctaacacatgtgctcccttattcatgttttgtgaattctattgcaaaaggggctaaatatgagaggggggacttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7690 |
tccttcatcttctgtgctaacacatgtgctcccttattcatgttttgtgaattctattgcaaaaggggctaaatatgagaggggggacttt |
7780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 13 - 166
Target Start/End: Original strand, 13174 - 13327
Alignment:
| Q |
13 |
aatatctagataaaccggacttttaaggcgagaatagtagtgaagtgcttcttcgatgtctagtacgtgttcaagatcacctgaatccatcatatctaat |
112 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| ||||||||||| | | |
|
|
| T |
13174 |
aatatcgagataaactggacttttaaggcgagaatagtagtgaagtgcttcttctatgtctagcacatgttcaagatcacctgattccatcatatccatt |
13273 |
T |
 |
| Q |
113 |
tccttcatcttctgtgctaacacatgtgctcccttattcatgttttgtgaattc |
166 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13274 |
ttcttcatcttctgtgctaacacatgtgctcccttattcgtgttttgtgaattc |
13327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 43879189 - 43879078
Alignment:
| Q |
13 |
aatatctagataaaccggacttttaaggcgagaatagtagtgaagtgcttcttcgatgtctagtacgtgttcaagatcacctgaatccatcatatctaat |
112 |
Q |
| |
|
|||||||| ||||| ||||| || || |||||||| ||||||||||||||||| || |||||||| ||||||| |||||||||||| |||| || ||| |
|
|
| T |
43879189 |
aatatctaaataaataggactcttgagacgagaataatagtgaagtgcttcttctatatctagtacttgttcaacatcacctgaatcattcatctccaat |
43879090 |
T |
 |
| Q |
113 |
tccttcatcttc |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43879089 |
tccttcatcttc |
43879078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University