View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0939_low_57 (Length: 226)
Name: NF0939_low_57
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0939_low_57 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 52390353 - 52390504
Alignment:
| Q |
5 |
caatattgataaggaaagataatatcattcattgatatatccttgcatgtacaaccgcagcctgaagaatacagtcatgtattacggaaatagatctcta |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52390353 |
caatattgataaggaaagataatatcattcattgatatatccttgcatgtacaaccgcagcctgaagaatacagtcatgtattacggaaatagatctctc |
52390452 |
T |
|
| Q |
105 |
tgtttgtcattctctagatttactcaattattatagtggacataattgaaat |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52390453 |
tgtttgtcattctctagatttactcaattattatagtggacataattgaaat |
52390504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 190 - 226
Target Start/End: Original strand, 52390568 - 52390604
Alignment:
| Q |
190 |
aatcaatcttctggtaataaattcttgtattacggac |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52390568 |
aatcaatcttctggtaataaattcttgtattacggac |
52390604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University