View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0939_low_59 (Length: 211)

Name: NF0939_low_59
Description: NF0939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0939_low_59
NF0939_low_59
[»] chr8 (1 HSPs)
chr8 (1-95)||(39436510-39436604)


Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 39436604 - 39436510
Alignment:
1 atatttacaactagatgagttcatgccccaactaccatcatttcaatcttactaatatattcttatttgtgggggaaaaactaccatatacaaag 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39436604 atatttacaactagatgagttcatgccccaactaccatcatttcaatcttactaatatattcttatttgtgggggaaaaactaccatatacaaag 39436510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University