View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_high_10 (Length: 417)
Name: NF0940_high_10
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_high_10 |
 |  |
|
| [»] scaffold0179 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 1e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 14 - 181
Target Start/End: Complemental strand, 894437 - 894284
Alignment:
| Q |
14 |
tattagtcctttgcaaataatacaaaaaagaaaattgtaattgaagagtgaggttgagggaacggggatgaggggatccctggtggtaacaaagcacttt |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
894437 |
tattggtcctttgcaaataatacaaaaaagaaaattgtaattgaagagtgaggttgaggg--------------gatccctggtggtaacaaatgacttt |
894352 |
T |
 |
| Q |
114 |
catggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894351 |
catggttaattgattccgctaccattgcaatatcgtggtaaaattatatcttatttcttctctcttgc |
894284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 105; Significance: 3e-52; HSPs: 3)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 33 - 176
Target Start/End: Original strand, 6288 - 6436
Alignment:
| Q |
33 |
atacaaaaaagaaaattgtaattgaagagtgaggttgagggaacggggatgaggggatccctggtggtaac-----aaagcactttcatggttaattgat |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| | ||| |
|
|
| T |
6288 |
atacaaaaaagaaaattgtaattgaagagtgaggttgagggaacggggaagaggggatccctggtggtaacaaattaaagcactttcatggttgttggat |
6387 |
T |
 |
| Q |
128 |
tccgctaccattgcaatatcgtggtaaaattatatcttatttcttctct |
176 |
Q |
| |
|
||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6388 |
tccactaccattgcaatattgtggtaaaattatatcttatttcttctct |
6436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 205 - 313
Target Start/End: Original strand, 6462 - 6570
Alignment:
| Q |
205 |
tccattcctctcctttctcctctaggataannnnnnnncttctccttttcgcttactaatctttttatagactctatcaatgaatccaccactctcaaca |
304 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6462 |
tccatccctctcctttctcctctaggatattttttttccttctccttttcgcttattaatctttttatagactctatgaatgaatccaccactctcaaca |
6561 |
T |
 |
| Q |
305 |
ccctgaaaa |
313 |
Q |
| |
|
|||| |||| |
|
|
| T |
6562 |
ccctcaaaa |
6570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 371 - 403
Target Start/End: Original strand, 6629 - 6661
Alignment:
| Q |
371 |
gggtgtttgattattggtgaatttgtgtctgtg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6629 |
gggtgtttgattattggtgaatttgtgtctgtg |
6661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University