View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_high_15 (Length: 364)
Name: NF0940_high_15
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_high_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 210 - 354
Target Start/End: Original strand, 8067523 - 8067667
Alignment:
| Q |
210 |
ttcaagtctctctcttattttctatcgaagcgaccgatcatgtgtgtgctctcaattctttttgtttgtacgagagaacctaacagagatatcaaatcgg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8067523 |
ttcaagtctctctcttattttctatcgaagcgaccgatcatgtgtgtgctctcaattctttttgtttgtacgagagaacctaacagagatatcaaatcgg |
8067622 |
T |
 |
| Q |
310 |
acaaagaccaacacaatatcataaccgttgttcatgacttctctg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8067623 |
acaaagaccaacacaatatcataaccgttgttcatgacttctctg |
8067667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 109 - 201
Target Start/End: Original strand, 8061760 - 8061852
Alignment:
| Q |
109 |
ataatggaagttgggaatttcatttgacattatgtgactttcataagacactagttttggacagacatgtttaaaaaataattggcataaact |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8061760 |
ataatggaatttgggaatttcatttgacattatgtgactttcataagacactagttttggacagacatgtttaaaaaataattggcataaact |
8061852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 8061652 - 8061726
Alignment:
| Q |
1 |
ttgaatcacaaaaatgattctattatgaagcttaacattcaatgatacttatatttgacattatctgcccttata |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8061652 |
ttgaatcacaaaaatgattctattatgaagcatatcattcaatgatgcttatatttgacattatctgcccttata |
8061726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 291
Target Start/End: Original strand, 47140061 - 47140115
Alignment:
| Q |
240 |
cgaccgatcatgtgtgtg---ctctcaattctttttgtttgtacgagagaaccta |
291 |
Q |
| |
|
|||| ||||||||||||| |||||||||||| |||||||| |||||||||||| |
|
|
| T |
47140061 |
cgactgatcatgtgtgtgtgactctcaattcttcttgtttgtgcgagagaaccta |
47140115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University