View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_high_16 (Length: 349)
Name: NF0940_high_16
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0940_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 185 - 335
Target Start/End: Original strand, 33845058 - 33845207
Alignment:
Q |
185 |
ctgcagtggatggaggaatgaaaaattccatgctttctgtgacaaaacgattacaccaatatatgaatcaatgtttttcaatcaaaatatgaaacaaatg |
284 |
Q |
|
|
||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
33845058 |
ctgcagtggatggaggaatgacaaat-ccatgctttctgggacaaaacgattacaccaatatatgaatcaatgtttttcaatcaaaatatcaaacaaatg |
33845156 |
T |
 |
Q |
285 |
agttaaaaaatgtaacattttcaaagaacatagctttttaatcgaatcacc |
335 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33845157 |
agttcaaaaatgtaacattttcaaagaacatagctttttaatcgaatcacc |
33845207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 33844929 - 33844985
Alignment:
Q |
30 |
taatcaagtttggtgaaaatagggtaatggtgaaaattgttatgacttgatcaactt |
86 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33844929 |
taatcaagtttggtgaaaatagggtaatggtgaaaattgttatgacttgatcaactt |
33844985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University