View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_high_17 (Length: 341)
Name: NF0940_high_17
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 74 - 249
Target Start/End: Complemental strand, 32227211 - 32227036
Alignment:
| Q |
74 |
ttattctaactagtaatttttatagttacaaatgagacttgtattgtaggttccttaagtagttttaatcacaccttgtgattttgagcttaacatacac |
173 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32227211 |
ttattctaactagcaatttttatagttacaaatgagacttgtattgtaggttacttaagtagttttaatcacaccttgtgattttgagcttaacatacac |
32227112 |
T |
 |
| Q |
174 |
attaaattatctaaatgcagattttaatattgtgattgtttgtgaatatatatgtataattattaacagtaacgtg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32227111 |
attaaattatctaaatgcagattttaatattgtgattgtttgtgaatatatatgtacaattattaacagtaacgtg |
32227036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University