View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_low_10 (Length: 436)
Name: NF0940_low_10
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 85 - 340
Target Start/End: Original strand, 9502556 - 9502811
Alignment:
| Q |
85 |
cataggctgtaggaaggaaatggaggatgcggtgagtgtggggataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502556 |
cataggctgtaggaaggaaatggaggatgcggtgagtatggagataggttttacgatgaaggatggagagaagtgtgatttcttcggtgtttatgatggt |
9502655 |
T |
 |
| Q |
185 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggtcgagatgtgttgggaggatagggaatgggattggg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
9502656 |
cacggtggtgctcaggtggcggtgtcgtgtagagagaggttgtataggattgtggcggaggaggttgagatgttttgggaggatagggaatgggattggg |
9502755 |
T |
 |
| Q |
285 |
agagggtgatggaagggtgttttggtaaaatggatagggaggtggcgggtgatgcc |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9502756 |
agagggtgatggaagggtgttttggtaaaatggatagggaggtggcgggtgatgcc |
9502811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University