View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0940_low_21 (Length: 349)

Name: NF0940_low_21
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0940_low_21
NF0940_low_21
[»] chr6 (2 HSPs)
chr6 (185-335)||(33845058-33845207)
chr6 (30-86)||(33844929-33844985)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 185 - 335
Target Start/End: Original strand, 33845058 - 33845207
Alignment:
185 ctgcagtggatggaggaatgaaaaattccatgctttctgtgacaaaacgattacaccaatatatgaatcaatgtttttcaatcaaaatatgaaacaaatg 284  Q
    ||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
33845058 ctgcagtggatggaggaatgacaaat-ccatgctttctgggacaaaacgattacaccaatatatgaatcaatgtttttcaatcaaaatatcaaacaaatg 33845156  T
285 agttaaaaaatgtaacattttcaaagaacatagctttttaatcgaatcacc 335  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||    
33845157 agttcaaaaatgtaacattttcaaagaacatagctttttaatcgaatcacc 33845207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 33844929 - 33844985
Alignment:
30 taatcaagtttggtgaaaatagggtaatggtgaaaattgttatgacttgatcaactt 86  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33844929 taatcaagtttggtgaaaatagggtaatggtgaaaattgttatgacttgatcaactt 33844985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University