View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_low_35 (Length: 259)
Name: NF0940_low_35
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 129
Target Start/End: Original strand, 35093087 - 35093175
Alignment:
| Q |
39 |
actaacctcacctctttaattacactgggaattaaataaaacattgaaactaacccagcaacgtaatagagata--tgcatagatatgaacac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35093087 |
actaacctcacctctttaattacactgggaattaaa----acattgaaactaacccagcaacgtaatagagatatttgcatagatatgaacac |
35093175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 241
Target Start/End: Original strand, 35093243 - 35093283
Alignment:
| Q |
201 |
tttgttgccaacccctcattcatgatcatatttgatttcat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
35093243 |
tttgttgccaacccctcattcatgatcatatttcatttcat |
35093283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University