View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0940_low_35 (Length: 259)

Name: NF0940_low_35
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0940_low_35
NF0940_low_35
[»] chr6 (2 HSPs)
chr6 (39-129)||(35093087-35093175)
chr6 (201-241)||(35093243-35093283)


Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 39 - 129
Target Start/End: Original strand, 35093087 - 35093175
Alignment:
39 actaacctcacctctttaattacactgggaattaaataaaacattgaaactaacccagcaacgtaatagagata--tgcatagatatgaacac 129  Q
    ||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||  |||||||||||||||||    
35093087 actaacctcacctctttaattacactgggaattaaa----acattgaaactaacccagcaacgtaatagagatatttgcatagatatgaacac 35093175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 201 - 241
Target Start/End: Original strand, 35093243 - 35093283
Alignment:
201 tttgttgccaacccctcattcatgatcatatttgatttcat 241  Q
    ||||||||||||||||||||||||||||||||| |||||||    
35093243 tttgttgccaacccctcattcatgatcatatttcatttcat 35093283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University