View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_low_41 (Length: 238)
Name: NF0940_low_41
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0940_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 49665679 - 49665555
Alignment:
Q |
1 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49665679 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
49665580 |
T |
 |
Q |
101 |
aagtagaagtatcactaccactgtg |
125 |
Q |
|
|
||||||||||| ||| |||||||| |
|
|
T |
49665579 |
aagtagaagtagtactgccactgtg |
49665555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 49709236 - 49709112
Alignment:
Q |
1 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49709236 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
49709137 |
T |
 |
Q |
101 |
aagtagaagtatcactaccactgtg |
125 |
Q |
|
|
||||||||||| ||| |||||||| |
|
|
T |
49709136 |
aagtagaagtagtactgccactgtg |
49709112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 49210376 - 49210252
Alignment:
Q |
1 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
100 |
Q |
|
|
|||||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| ||||||| |
|
|
T |
49210376 |
gaaacaaagtgagaggtgggaggaagagtataactatatctgaaagcttcacaacttttgttttgcagcattttgtagagattaatgtctctaaaaacac |
49210277 |
T |
 |
Q |
101 |
aagtagaagtatcactaccactgtg |
125 |
Q |
|
|
|||||||||||| |||||||||||| |
|
|
T |
49210276 |
aagtagaagtattactaccactgtg |
49210252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 144
Target Start/End: Original strand, 41686253 - 41686396
Alignment:
Q |
1 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaacttttgttttgcagcagtttgtagagattattgtctctgaaaacac |
100 |
Q |
|
|
|||||||||||| ||||||| ||| ||||||| ||||||||||||| ||||||| || || || | |||||||||||||||||||||||| ||||||| |
|
|
T |
41686253 |
gaaacaaagtgagaggtggggggaagagtatagttatatctgaaagtttcacaatttctggattaaaacagtttgtagagattattgtctctaaaaacac |
41686352 |
T |
 |
Q |
101 |
aagtagaagtatcactaccactgtgaaaatcaagaggagttaca |
144 |
Q |
|
|
|| ||| |||| || ||||||||||| | ||| ||||| ||||| |
|
|
T |
41686353 |
aattaggagtagcattaccactgtgatactcaggaggacttaca |
41686396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 18317602 - 18317550
Alignment:
Q |
1 |
gaaacaaagtgataggtgggaggaggagtataattatatctgaaagcttcacaa |
54 |
Q |
|
|
|||||||||||| ||||||| ||| ||||||| |||||| |||||||||||||| |
|
|
T |
18317602 |
gaaacaaagtgagaggtggg-ggaagagtatagttatatttgaaagcttcacaa |
18317550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University