View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0940_low_42 (Length: 219)
Name: NF0940_low_42
Description: NF0940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0940_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 28216335 - 28216464
Alignment:
| Q |
1 |
agattgtaaacatatttataatccagaggactcctaagtttgtgcatgataataaactttaaacttaagatgtaacaactaaaattgatgctgtcaagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28216335 |
agattgtaaacatatttataatcctaaggactcctaatttcgtgcatcataataaactttaaacttaagatgtaacaactaaaattgatgctgtcaagtt |
28216434 |
T |
|
| Q |
101 |
gtaatggttgtaaccaaccatttacaccat |
130 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
28216435 |
gtaatggttgtagccaaccatttacaccat |
28216464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University