View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_high_17 (Length: 480)
Name: NF0941_high_17
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 30 - 342
Target Start/End: Complemental strand, 33327689 - 33327377
Alignment:
| Q |
30 |
caccaaacaaccgtcgagctggactgtgcctccgcacgtgtcgcggcacatgtcaccggcacgtgtgacagcgcgtgcgacacaggaggcacagtccggc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327689 |
caccaaacaaccgtcgagctggactgtgcctccgcacgtgtcgcggcacatgtcaccggcacgtgtgacagcgcgtgcgacacaggaggcacagtccggc |
33327590 |
T |
 |
| Q |
130 |
atagcgaggtcgccacggcattgatataggccatagattatgtcttgttgggtggaccctaggacggtgaagttgttgtaggatgagtatgttgctgagt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33327589 |
atagcgaggtcgccacggcattgatataggccatagattatgtcttgttgggtggaccctaggacggtgaagttgttgtaggatgagtatgttgctgaat |
33327490 |
T |
 |
| Q |
230 |
tgactagtgaagtgaggagtgaatttaggtttgactcgtaaggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggtagaggtttgtggt |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327489 |
tgactagtgaagtgaggagtgaatttaggtttgactcgtagggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggtagaggtttgtggt |
33327390 |
T |
 |
| Q |
330 |
tgatgattctgat |
342 |
Q |
| |
|
||||||||||||| |
|
|
| T |
33327389 |
tgatgattctgat |
33327377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 377 - 472
Target Start/End: Complemental strand, 33327342 - 33327229
Alignment:
| Q |
377 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagag------------------taggttatattatatgcatatagaatatgtgatg |
458 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
33327342 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagagtatgtaatatgtatgcaatatgttatattatatgcatatagaatatgtgatg |
33327243 |
T |
 |
| Q |
459 |
tgataccctatgat |
472 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33327242 |
tgataccctatgat |
33327229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 195 - 269
Target Start/End: Complemental strand, 29527434 - 29527360
Alignment:
| Q |
195 |
ggtgaagttgttgtaggatgagtatgttgctgagttgactagtgaagtgaggagtgaatttaggtttgactcgta |
269 |
Q |
| |
|
||||||||| |||||||||| ||| ||||||||||||| ||| || ||||||||||| |||||||| || ||||| |
|
|
| T |
29527434 |
ggtgaagttattgtaggatgtgtaggttgctgagttgattagggatgtgaggagtgagtttaggttggattcgta |
29527360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University