View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_high_43 (Length: 330)
Name: NF0941_high_43
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_high_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 2 - 322
Target Start/End: Original strand, 16814386 - 16814706
Alignment:
| Q |
2 |
gaaatggcaaaccgttgttacaacatcgtctatggcggcggttgtccaaggttgtcttataaacccgatgttgctccccatcctcaacatcagggtcggt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
16814386 |
gaaatggcaaaccgttgttacaacatcgtctatggcggcggtcgtccacagttgtcttataaacccgttgttgctctccatcctcaacatcagggtcggt |
16814485 |
T |
 |
| Q |
102 |
tctttctctgaaggcatagtccagaatctgcctcttcttggtggaggatgctggtttctgtggattaaaacattggttgttataggccgtaaaatgttat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||||| |||||||||| | |
|
|
| T |
16814486 |
tctttctctgaaggcatagtccagaatctgccttttcttggtggtggatgctggtttctgttgatcaaaacattggttgttataggctgtaaaatgttgt |
16814585 |
T |
 |
| Q |
202 |
tctattcgccgatgtatgtgttcgaatacccttttacaggtttgatttctcaaaatatgcgtttcacgcatggttatgctcccccaagatcatcgttagt |
301 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||| |
|
|
| T |
16814586 |
tctattccccgatgtatgtgttcgaatacccttttacaggtttgatttctcaaaatatgcgtttcacgcatggttctgttcccccaagatcattgttagt |
16814685 |
T |
 |
| Q |
302 |
gtggttgttattgtctgtgct |
322 |
Q |
| |
|
|||||||||| ||| |||||| |
|
|
| T |
16814686 |
gtggttgttagtgtatgtgct |
16814706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University