View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_high_70 (Length: 251)
Name: NF0941_high_70
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_high_70 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 251
Target Start/End: Original strand, 40653467 - 40653688
Alignment:
| Q |
30 |
tgtcgtcgaatggctgttcgcagagtagatgctctgttactaactgattctaatgctttgctctgtggaatcctcacagacaaggtatgactcgatcttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40653467 |
tgtcgtcgaatggctgttcgcagagtagatgctctgttactaactgattctaatgctttgctctgtggaatcctcacagacaaggtatgactcgatcttc |
40653566 |
T |
 |
| Q |
130 |
cttttattactttgacaagagagaaaaatatggaaaggaatggaattggatttctgcacaaaaagcatgcataactggctgtcctattttttgtggttaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40653567 |
cttttattactttgacaagagagaaaaatatggaaaggaatggaattggatttctgcacaaaaagcatgcataactggctgtcctattttttgtggttaa |
40653666 |
T |
 |
| Q |
230 |
aggatatattaacaagagttat |
251 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40653667 |
aggatatattaacaagagttat |
40653688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 121
Target Start/End: Original strand, 45427925 - 45428016
Alignment:
| Q |
30 |
tgtcgtcgaatggctgttcgcagagtagatgctctgttactaactgattctaatgctttgctctgtggaatcctcacagacaaggtatgact |
121 |
Q |
| |
|
|||||||| ||||||| || || || |||||||| ||||| || |||||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
45427925 |
tgtcgtcggatggctgcccgtagggtggatgctctattactcaccgattctaatgggttgctttgtggaatcctcacagacaaggtgtgact |
45428016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 84
Target Start/End: Complemental strand, 4442 - 4392
Alignment:
| Q |
34 |
gtcgaatggctgttcgcagagtagatgctctgttactaactgattctaatg |
84 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| || ||||||||||| |||| |
|
|
| T |
4442 |
gtcgaatggctgtttgcaaagtagatgctctatttctaactgattcgaatg |
4392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 34 - 84
Target Start/End: Original strand, 144747 - 144797
Alignment:
| Q |
34 |
gtcgaatggctgttcgcagagtagatgctctgttactaactgattctaatg |
84 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| || ||||||||||| |||| |
|
|
| T |
144747 |
gtcgaatggctgtttgcaaagtagatgctctatttctaactgattcgaatg |
144797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University