View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_high_75 (Length: 247)
Name: NF0941_high_75
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_high_75 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 34870586 - 34870817
Alignment:
| Q |
1 |
tcaaatttcaccaatgtcttcaccaaaatcgacatgcaagtataagaggaagtcatgtaaagggatcatgtcatgtgctatgcatccctcacattggata |
100 |
Q |
| |
|
||||||||||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34870586 |
tcaaatttcaccaatttcttcaccaaactccacatgcaagtataagaggaagtcatgtaaagggatcatgtcatgtgctatgcatccctcacattggata |
34870685 |
T |
|
| Q |
101 |
caacattgatgtcgacacacaaacactgataataatttaagaaaatagtaatgattctacacaaccacgtgtgtcaggattctatgctcattaattttta |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34870686 |
cgacattgatgtcgacacacaaacactgataataatttgagaaaatagtagtgattctacacaaccacgtgtgtcaggattttatgctcattaatttttg |
34870785 |
T |
|
| Q |
201 |
gattggggttattctcgtgatgattgtctatc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34870786 |
gattggggttattctcgtgatgattgtctatc |
34870817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University