View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_100 (Length: 215)
Name: NF0941_low_100
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_100 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 82 - 186
Target Start/End: Complemental strand, 46015630 - 46015526
Alignment:
| Q |
82 |
aagggtgaggttattttaatatggttgattgaaagttaaaaaaggaacaaggcacaacaacaatagcaacgaacagaatagaagaacggcaatggatata |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
46015630 |
aagggtgaggttattttaatatggttgattgaaagttaaaaaaggaacaaggcacaacaacaatagcaactaacagaatagaagaacggcattggatata |
46015531 |
T |
 |
| Q |
182 |
ataat |
186 |
Q |
| |
|
||||| |
|
|
| T |
46015530 |
ataat |
46015526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University