View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0941_low_101 (Length: 212)

Name: NF0941_low_101
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0941_low_101
NF0941_low_101
[»] chr8 (1 HSPs)
chr8 (53-133)||(43148592-43148672)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 53 - 133
Target Start/End: Original strand, 43148592 - 43148672
Alignment:
53 gttctttcaactacatagcagccattcatttcctttcagctacatacataactaccatcccttttcaaccctctgcctatg 133  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||    
43148592 gttctttcaactacatagcagccattcatttcctttcagctacatacataaccaccatcccttttcaaccctctgtctatg 43148672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University