View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_101 (Length: 212)
Name: NF0941_low_101
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_101 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 53 - 133
Target Start/End: Original strand, 43148592 - 43148672
Alignment:
| Q |
53 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataactaccatcccttttcaaccctctgcctatg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
43148592 |
gttctttcaactacatagcagccattcatttcctttcagctacatacataaccaccatcccttttcaaccctctgtctatg |
43148672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University