View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_106 (Length: 201)
Name: NF0941_low_106
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0941_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 35153925 - 35153830
Alignment:
Q |
10 |
aatatggtcgttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatt--tatgttttaatcaacttcattct |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
35153925 |
aatatggtcgttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttatatgttttaatcaacttcattct |
35153830 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 27133630 - 27133561
Alignment:
Q |
19 |
gttagttttaaattaccatgcttagtaattaacttaatctgttttttaatgtgcatataatttatgttttaatcaa |
94 |
Q |
|
|
||||||||||||||||||| |||||||||| || | || ||||||||||||||||||||||||||||||| |
|
|
T |
27133630 |
gttagttttaaattaccatacttagtaattcacat------ttaattaatgtgcatataatttatgttttaatcaa |
27133561 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University