View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_48 (Length: 362)
Name: NF0941_low_48
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 30 - 329
Target Start/End: Complemental strand, 5441519 - 5441220
Alignment:
| Q |
30 |
catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcactatgtagttacaacttgagaagat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5441519 |
catacaataactatgaacatatctataaagttgatagaatgggtaacctcccatacctgatccaaatgaacatcaatatgtagttacaacttgagaagat |
5441420 |
T |
 |
| Q |
130 |
tgatagcattcaatttgtgagtcattatctatttgcctatgccttatccatgaatgtgatgttacaatcaaaccctatcatcagttcatcacatattcta |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441419 |
agatagcattcaatttatgagtcattatctatttgcctatgccttatccatgaatgtgatgttacaatcaaaccctatcatcagttcatcacatattcta |
5441320 |
T |
 |
| Q |
230 |
ttctcttcaaacaaattaaatttgtggataaaatttaagaaatcaaatgcattacgtatgtcaaatccaaagggacacaatttcatattattaattgttg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441319 |
ttctcttcaaacaaattaaatttgtggataaaatttaagaaatcaaatgcattacgaatgtcaaatccaaagggacacaatttcatattattaattgttg |
5441220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University