View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_50 (Length: 333)
Name: NF0941_low_50
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 54 - 300
Target Start/End: Complemental strand, 41606590 - 41606342
Alignment:
| Q |
54 |
gctactgcttctactgcattctgtgtaggtttagaaacttctgataaaggatggcttggtaactttgattcttgtaacaacagatggcctagacaagaga |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41606590 |
gctactgcttctactgcattctgtgtaggtttagaaacttctgataaaggatggcttggtaactttgattcttgtaacaacagatggcccagacaagaga |
41606491 |
T |
 |
| Q |
154 |
ctctttctcttctagaaatcagatctcgtcttgattctaagttcagagagaataatcagaaagcacccttgtggaatgaaatttctaggtatatgttagt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41606490 |
ctctttctcttctagaaatcagatctcgtcttgattctaagttcagagagaataatcagaaagcacccttgtggaatgaaatttctaggtatatgttagt |
41606391 |
T |
 |
| Q |
254 |
gtcttaa--ctcttaattaattactggtttaccaagctttttatttcac |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41606390 |
gtcttaactctcttaattaattactggtttaccaagctttttatttcac |
41606342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 135 - 187
Target Start/End: Original strand, 26598001 - 26598053
Alignment:
| Q |
135 |
agatggcctagacaagagactctttctcttctagaaatcagatctcgtcttga |
187 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
26598001 |
agatggccaagacaagaaactcttactcttcttgaaatcagatctcgtcttga |
26598053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University