View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_62 (Length: 312)
Name: NF0941_low_62
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 301
Target Start/End: Original strand, 38569320 - 38569598
Alignment:
| Q |
30 |
tcaattatggcttgaaacttaagaaaccggctcatatgaaattacatgcctttagtgatgcagattggggagactacttagatgatt-cagtg------t |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || | | |
|
|
| T |
38569320 |
tcaattatggcttgaaacttaagaaaccggctcatatgaaattacatgcctttagtgatgcaaattggggagactacttagatgatcacacttctacctt |
38569419 |
T |
 |
| Q |
123 |
cgtggaggtaatttattttggaggtaattcagtgttgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcgttcagta |
222 |
Q |
| |
|
| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38569420 |
aacgtttgtaatttattttggaggtaattcagtgtcgtggctatccaagagacagagaactgtggcacgatcatcaccggaagctgaatatcattcagta |
38569519 |
T |
 |
| Q |
223 |
gcaaatgctacagtagaggtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt |
301 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38569520 |
gcaaatgctgcagcagaggtcatgtggttgacaaaccttctcagtggattacatgtcaaaacaccagctcctcatctgt |
38569598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University