View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_63 (Length: 309)
Name: NF0941_low_63
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_63 |
 |  |
|
| [»] scaffold0361 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 29 - 301
Target Start/End: Original strand, 41570005 - 41570278
Alignment:
| Q |
29 |
acgatgaactcttcgatgacagcaacatcatggacgctgtttgtcgcccttccttttctggtacttgttatcacttgtaaaattgtttcattctaaccct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41570005 |
acgatgaactcttcgatgacagcaacatcatggacgctgtttgtcgcccttccttttctggtacttgttatcacttgtaaaattgtttcattctaaccct |
41570104 |
T |
 |
| Q |
129 |
aacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatctttctttcctgtttta-ttgttagatgtgttcgatccgt |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
41570105 |
aacaaaaatataactattcaatttcaatctatattttgattaacaaatacttaactttatttttctttcctgttttattttttagatgtgttcgatccgt |
41570204 |
T |
 |
| Q |
228 |
tttcttctactaggagcttgaaccatgtctttaacatggtggatcaatcaattaacaatccgttcctctctgct |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41570205 |
tttcttctactaggagcttgaaccatgtccttaacatggtggatcaatcaattaacaatccgttcctctctgct |
41570278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0361 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0361
Description:
Target: scaffold0361; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 209 - 301
Target Start/End: Complemental strand, 9193 - 9101
Alignment:
| Q |
209 |
ttagatgtgttcgatccgttttcttctactaggagcttgaaccatgtctttaacatggtggatcaatcaattaacaatccgttcctctctgct |
301 |
Q |
| |
|
||||||||||| |||||||||||| | |||||||| |||| ||| || |||||||||||||||||| ||| ||||||| ||||| |||||| |
|
|
| T |
9193 |
ttagatgtgtttgatccgttttctccaactaggagtttgagccaggtgcttaacatggtggatcaattaatggacaatccattcctttctgct |
9101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University