View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_76 (Length: 276)
Name: NF0941_low_76
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0941_low_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 127 - 261
Target Start/End: Original strand, 40859788 - 40859922
Alignment:
Q |
127 |
acgcaataaagagatccaacataatatagctaggcagccccataagaaagtaacaatgccattcttataatcaataactttatcaccacgtttcttgagc |
226 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40859788 |
acgcaataaagagatccaacagaatatagctaggcagccccataagaaagtaacaatgccattcttataatcaataactttatcaccacgtttcttgagc |
40859887 |
T |
 |
Q |
227 |
agcacttatacagttgtcacttttggctagtacat |
261 |
Q |
|
|
|||||||||||||||||||||| |||||||||||| |
|
|
T |
40859888 |
agcacttatacagttgtcacttgtggctagtacat |
40859922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 32 - 94
Target Start/End: Original strand, 40859699 - 40859761
Alignment:
Q |
32 |
tactatgtcatgtgttttctgatcactgtcttttcccttggatctcctttacttggatgatac |
94 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40859699 |
tactatgtcatgtgttttctgatcactgtcttttcccttggatctcctttacttggatgatac |
40859761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University