View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_77 (Length: 271)
Name: NF0941_low_77
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0941_low_77 |
 |  |
|
[»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 154 - 271
Target Start/End: Complemental strand, 1577056 - 1576940
Alignment:
Q |
154 |
tatctaccgttttggtaaaaccaaatgtatcttcggtagacaattgtgaatactaatccttttgtaatttatgagatacgttgcatctagttaaacaatt |
253 |
Q |
|
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
1577056 |
tatctaccgttttggtaaa-ccaaatgtatcttctatagacaattgtgaatactaatccttttgagatttatgagatacgttgcatctagttaaacaatt |
1576958 |
T |
 |
Q |
254 |
ttattattttgattgtaa |
271 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
1576957 |
ttattattttgattgtaa |
1576940 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 50 - 93
Target Start/End: Complemental strand, 1579945 - 1579902
Alignment:
Q |
50 |
attttcatcatattgatgacctcgactataacaaggcaatggaa |
93 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
1579945 |
attttcatcatattgatgacctcgactatagcaaggcaatggaa |
1579902 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 143
Target Start/End: Complemental strand, 1577169 - 1577121
Alignment:
Q |
95 |
gagtttgtatgactgttatggtttgcttgtaattattctttgtaaaaga |
143 |
Q |
|
|
|||||||||||| |||| ||||||| ||||||||||| |||||||||| |
|
|
T |
1577169 |
gagtttgtatgattgttgtggtttgtttgtaattatttgttgtaaaaga |
1577121 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University