View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_80 (Length: 268)
Name: NF0941_low_80
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_80 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 32 - 215
Target Start/End: Original strand, 27644737 - 27644920
Alignment:
| Q |
32 |
ttctcacaatactcgattatcaagggaagttcagagctcgtaacattgtgaagaggaacagttgtaatttttccatcgctttcgtcgacgaaggattgaa |
131 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27644737 |
ttctcgcaatactcgattatcaagggaagttcagagctcgtaacattgtgaagaggaacagttgtaatttttccatcgctttcgtcgacgaaggattgaa |
27644836 |
T |
 |
| Q |
132 |
ccgttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgaga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27644837 |
ccgttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgaga |
27644920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 35 - 224
Target Start/End: Original strand, 27549236 - 27549425
Alignment:
| Q |
35 |
tcacaatactcgattatcaagggaagttcagagctcgtaacattgtgaagaggaacagttgtaatttttccatcgctttcgtcgacgaaggattgaaccg |
134 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||| | ||||||||| |||||||| ||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
27549236 |
tcacaatacttgatgatcaagggaagttcagagcttgaaacattgtggagaggaacggttgtgatttttccatcactttcgtcgacgaaggtttgaaccg |
27549335 |
T |
 |
| Q |
135 |
ttgccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcggaggtgatgagtgagatcattgtttctgagagggagagtg |
224 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| |||||||| |||| |
|
|
| T |
27549336 |
ttcccatctcctttgcaattgagggtttgactttgaaaacgacgttgtcagaggttatgagtgagatcattgtttcggagagggatagtg |
27549425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University