View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_87 (Length: 257)
Name: NF0941_low_87
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_87 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 247
Target Start/End: Complemental strand, 8687121 - 8686880
Alignment:
| Q |
6 |
aaatacttatgctggtttaattttattattgagtattttcatgcgttggttaaggttaaataatctgaggacttctagctagccacatctcgatcgatta |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8687121 |
aaatacttatgctggtttaattttattattgagtattttcatgcgttggttaaggttaaataatctgaggacttctagctagccacatctcgatcgatta |
8687022 |
T |
|
| Q |
106 |
ttgtatattgctacataaaatcttcttttctatatattagaatataaagtcttcaacgagtgcagggaaaatatttagtcttcaccaccttcgtgtattt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8687021 |
ttgtatattgctacataaaatcttcttttctatatattagaatataaagtcttcaacgagtgcagggaaaatatttagtcttcactaccttcgtgtattt |
8686922 |
T |
|
| Q |
206 |
tgcatgaggtagtacatccaacaacattcccctcactctgtg |
247 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8686921 |
tgcaagaggtagcacatccaacaacattcccctcactctgtg |
8686880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 76
Target Start/End: Original strand, 8675346 - 8675423
Alignment:
| Q |
1 |
ttaataaatacttatgctggtttaattttat--tattgagtattttcatgcgttggttaaggttaaataatctgagga |
76 |
Q |
| |
|
|||||||||| ||||| ||||||| |||||| ||| |||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
8675346 |
ttaataaatatttatgttggtttagttttatattatcgagtattttcgtgcgttggttaaggttaaatattctgagga |
8675423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University