View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_93 (Length: 251)
Name: NF0941_low_93
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_93 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 183
Target Start/End: Complemental strand, 35805495 - 35805313
Alignment:
| Q |
1 |
caaggaaaaacaaaagagaagcttaaaattaatatgatataatgcatgtttgaggtatctagtgaaataagtagtgaataaaattggatgtgtttagatg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805495 |
caaggaaaaacaaaagagaagctaaaaattaatatgatataatgcatgtttgaggcatctagtgaaataagtagtgaataaaattggatgtgtttagatg |
35805396 |
T |
 |
| Q |
101 |
tctagggatgtcataaataagtaatggtgttaacattttttgtcttttgtatatgagaaagtgttgcatacaaaatttgaatt |
183 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35805395 |
tctagggatgtaataaataagtaatggtgttaacattttttgtcttttgtatatgagaaagtgttacatacaaaatttgaatt |
35805313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 175 - 222
Target Start/End: Original strand, 35808554 - 35808601
Alignment:
| Q |
175 |
atttgaattcatcatatcattggaaaaagaagaagtaggagtagcagc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35808554 |
atttgaattcatcatatcattggaaaaagaagaagtaggagtagcagc |
35808601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University