View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0941_low_99 (Length: 229)
Name: NF0941_low_99
Description: NF0941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0941_low_99 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 115 - 229
Target Start/End: Original strand, 16814493 - 16814607
Alignment:
| Q |
115 |
ctgaaggcatagtccagaatctgcctcttcttggtggaggatgctggtttctgtggattaaaacattggttgttataggccgtaaaatgttattctattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||| ||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
16814493 |
ctgaaggcatagtccagaatctgccttttcttggtggtggatgctggtttctgttgatcaaaacattggttgttataggctgtaaaatgttgttctattc |
16814592 |
T |
|
| Q |
215 |
gccgatgtatgtgtt |
229 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
16814593 |
cccgatgtatgtgtt |
16814607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 33717672 - 33717576
Alignment:
| Q |
1 |
caaattcatatttcaacccacaaatagtaatggatccacacacaatgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacaca |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33717672 |
caaattcatatttcaacccacaaatagtaatggatccacaaa--atgtaaacaaattataaaatgtaactaacatagactatttcaaagaatttacaca |
33717576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University