View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_101 (Length: 268)
Name: NF0942_high_101
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_high_101 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 8823264 - 8823379
Alignment:
| Q |
1 |
cttcttcttgtttttgtcttgtgtagctcaggagcaaaggttgtcactattgatgtacacgcagccaagaatctcatccagaccggtcacatttatcttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823264 |
cttcttcttgtttttgtcttgtgtagctcaggagcaaaggttgtcaccattgatgtacacgcagccaagaatctcatccagaccggtcacatttatcttg |
8823363 |
T |
 |
| Q |
101 |
atgttaggtaaaccta |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8823364 |
atgttaggtaaaccta |
8823379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 162 - 237
Target Start/End: Original strand, 8823425 - 8823500
Alignment:
| Q |
162 |
ataaacaaacaaaagaatcaacaaatcgagaaaataatctctttatcacaactttcccgtagataaagatttgata |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823425 |
ataaacaaacaaaagaatcaacaaatcgagaaaatgatctctttatcacaactttcccgtagataaagatttgata |
8823500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University