View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_117 (Length: 251)
Name: NF0942_high_117
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_high_117 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 84 - 235
Target Start/End: Original strand, 36076178 - 36076329
Alignment:
Q |
84 |
ggtgtaacgataataggataatcgtccttacatatttattatcatttgaaatgtttggggtgcatgggggagggaattttgttcctacactgcatgcgct |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36076178 |
ggtgtaacgataataggataatcgtccttacatatttattatcatttgaaatgtttggggtgcatgggggagggaattttgttcctacactgcatgcgct |
36076277 |
T |
 |
Q |
184 |
tggagcgcatggaggcacatcctggagtgcatggccagaaaaatgtgcggaa |
235 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36076278 |
tggagcgcatggaggcacatcctggagtgcatggccagaaaaatgtgcggaa |
36076329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University