View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0942_high_127 (Length: 234)

Name: NF0942_high_127
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0942_high_127
NF0942_high_127
[»] chr3 (2 HSPs)
chr3 (24-84)||(48392048-48392108)
chr3 (106-144)||(48392130-48392168)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 84
Target Start/End: Original strand, 48392048 - 48392108
Alignment:
24 agcaaaattctttaatgctataacagtaatacactaatttaaatgcaaaaattgtgattgc 84  Q
    ||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||    
48392048 agcaaaattctttaatgctataatagtaatacacaaatataaatgcaaaaattgtgattgc 48392108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 144
Target Start/End: Original strand, 48392130 - 48392168
Alignment:
106 atggaaatttaccttttagctacttggattgacttgatg 144  Q
    |||||||||||||||||||||||||||||||||||||||    
48392130 atggaaatttaccttttagctacttggattgacttgatg 48392168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University