View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_151 (Length: 205)
Name: NF0942_high_151
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_high_151 |
 |  |
|
| [»] scaffold0287 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 7e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 7e-51
Query Start/End: Original strand, 4 - 113
Target Start/End: Original strand, 3620799 - 3620908
Alignment:
| Q |
4 |
attggtgagatcaattgagagacgaccctgattttttaactcaagtaacacgtcaactatatccttctcttcatcatctttcttcctattattaggattg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3620799 |
attggtgagatcaattgagagacgaccctgattctttaactcaagtaacacgtcaactatatccttctcttcatcatcttttttcctattattaggattg |
3620898 |
T |
 |
| Q |
104 |
agatgttcct |
113 |
Q |
| |
|
|||||||||| |
|
|
| T |
3620899 |
agatgttcct |
3620908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 3631193 - 3631303
Alignment:
| Q |
1 |
atcattggtgagatcaattgagagacgaccctgattttttaactcaagtaacacgtcaactatatccttctcttcatcatctttcttcctattattagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
3631193 |
atcattggtgagatcaattgagagacgaccctgattctttaactcaagtaacacgtcaactatatccttctcttcttcatctttcttccgattattagga |
3631292 |
T |
 |
| Q |
101 |
ttgagatgttc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
3631293 |
ttgagatgttc |
3631303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0287 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: scaffold0287
Description:
Target: scaffold0287; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 14892 - 14782
Alignment:
| Q |
1 |
atcattggtgagatcaattgagagacgaccctgattttttaactcaagtaacacgtcaactatatccttctcttcatcatctttcttcctattattagga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
14892 |
atcattggtgagatcaattgagagacgaccctgattctttaactcaagtaacacgtcaactatatccttctcttcttcatctttcttccgattattagga |
14793 |
T |
 |
| Q |
101 |
ttgagatgttc |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
14792 |
ttgagatgttc |
14782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University